Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet: ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .

Article Snippet: Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).

Techniques: Inverted Microscopy, Imaging, Microscopy, Infection, Injection, CRISPR

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet: ( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.

Article Snippet: Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).

Techniques: Expressing, CRISPR, Injection

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet: ( A ) The percentage of larvae with neutrophil swarms at 3 hr post injury after gasdermin inhibitor, LDC7559, or DMSO treatment. Data shown are mean with a minimum of 120 larvae analysed in each group, accumulated from three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( B ) The percentage of larvae with neutrophil swarms at 4 hr post injury after neutrophil elastase inhibitor, MeOSu-AAPV-CMK, treatment, or DMSO control. Data shown are mean, with greater than 73 larvae per group over three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( C ) Representative fluorescence micrographs of the double transgenic Tg(mpx:GFP);Tg(lyz:nfsβ-mCherry) after myeloperoxidase knockdown using CRISPR-Cas9 with tyrosinase knockdown as a negative control. The myeloperoxidase guide RNA targeted the promoter of mpx , therefore knocking down expression of green mpx:GFP while leaving lyz:mCherry intact. White arrowhead indicates the presence of a swarm at the wound (white dashed line). ( D ) The percentage of larvae with neutrophil swarms at 4 hr post-injury after mpx knockdown by CRISPR-Cas9 or tyr control. Data shown are mean, with a minimum of 115 larvae analysed in each group, accumulated from three biological replicates . Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups. p-values in ( A ), ( C ), and ( D ) are generated from unpaired t-tests. Figure 7—source data 1. Numerical data for the graph of . Figure 7—source data 2. Numerical data for the graph of . Figure 7—source data 3. Numerical data for the graph of .

Article Snippet: Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).

Techniques: Fluorescence, Transgenic Assay, CRISPR, Negative Control, Expressing, Generated

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet:

Article Snippet: Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).

Techniques: Transgenic Assay, Infection, CRISPR, Sequencing, Recombinant, Plasmid Preparation, Software

Journal: Research and Practice in Thrombosis and Haemostasis

Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells

doi: 10.1002/rth2.12242

Figure Lengend Snippet: Schematic overview of the CRISPR clone generation workflow. Guide RNA s ( gRNA s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays

Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′.

Techniques: CRISPR, Clone Assay, Plasmid Preparation, Transfection, Control, Produced, Transduction, Virus, Marker, Enzyme-linked Immunosorbent Assay, High Throughput Screening Assay, Knock-Out, Western Blot, Sequencing, Functional Assay

Journal: Research and Practice in Thrombosis and Haemostasis

Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells

doi: 10.1002/rth2.12242

Figure Lengend Snippet: Screening and mutation analysis of VWF knockout clones. (A) Conditioned medium of single‐cell clones that had reached >50% confluence was collected, and an ELISA for (secreted) von Willebrand factor (VWF) was performed as a first screen for VWF‐ deficient clones. Arrows indicate control ( CTRL ) and gRNA targeted clones that were selected for further screening. (B) After selected clones had been expanded to 6‐well plates and reached confluence, cells were lysed and VWF deficiency was assayed using immunoblotting with polyclonal anti‐ VWF and anti‐β‐actin as a loading control. Two control clones ( CTRL A and CTRL B) and two VWF −/− clones ( VWF −/− A and VWF −/− B) were selected, as indicated by the arrows. (C) Sanger sequencing and next‐generation sequencing on exon 1 of VWF were used to identify CRISPR /Cas9‐induced mutations. Sanger sequence traces are shown for all clones, and major mutations in both VWF −/− clones are indicated in the figure

Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′.

Techniques: Mutagenesis, Knock-Out, Clone Assay, Enzyme-linked Immunosorbent Assay, Control, Western Blot, Sequencing, Next-Generation Sequencing, CRISPR

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet: ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .

Article Snippet: Other , lta4h Synthetic SynRNA , Merck , lta4h CRISPR guide RNA , AGGGTCTGAAACTGGAGTCA(TGG).

Techniques: Inverted Microscopy, Imaging, Microscopy, Infection, Injection, CRISPR

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet: ( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.

Article Snippet: Other , lta4h Synthetic SynRNA , Merck , lta4h CRISPR guide RNA , AGGGTCTGAAACTGGAGTCA(TGG).

Techniques: Expressing, CRISPR, Injection

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet:

Article Snippet: Other , lta4h Synthetic SynRNA , Merck , lta4h CRISPR guide RNA , AGGGTCTGAAACTGGAGTCA(TGG).

Techniques: Transgenic Assay, Infection, CRISPR, Sequencing, Recombinant, Plasmid Preparation, Software